Works (Ausschreibung №93786764de)

Bitte registrieren Sie sich

Teilen Sie dies:
Land: India
Sprache: EN
Nummer: 93786764
Veröffentlichungsdatum: 07-11-2023
Quelle:

Beschreibung

Vollständige Informationen zur Ausschreibung sind geschlossen.
Für weitere Arbeiten mit der Website lesen Sie die folgenden Informationen.

Über uns

Führende Suchmaschine für Angebote und Einkäufe in Russland und der Welt

  • Die größte Datenbank mit Ausschreibungen und Beschaffungsquellen in Russland und der Welt
  • Kostenloser täglicher Newsletter gemäß Ihren Einstellungen
  • Informationen zu Ausschreibungssiegern im gewünschten Format
  • Bequemes Anzeigen und Hochladen von Informationen

Wähle uns

Erste Schritte

Registrierung auf der Site, danach stehen Ihnen die folgenden Site-Funktionen zur Verfügung:

  • Abonnieren Sie kostenlose Mailinglisten für Ihre Schlüsselphrasen
  • Ausschreibungsankündigungen anzeigen
  • Zusammenfassungsinformationen im Excel-Format exportieren
  • Teil der Informationen zu den Gewinnern, Lieferanten und Kunden von Ausschreibungen anzeigen

Registrierung

Um alle Funktionen der Site nutzen und alle Informationen anzeigen zu können, müssen Sie ein kommerzielles Konto registrieren

  • Tarif ausgewählt
  • Bezahlen Sie den Zugriff auf eine der möglichen Arten

Voller Zugriff
Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probes and Primers. Scope: - qPCR Probe: ProFsgq1 - TGAATGCCATAGGTCAGAT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FSGq - TCTTCTAGGATGGGCTGGT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FVMGB - ACTCAGCGCCCAGGA with FAM+MGBNFQ, Qty: 1; - Probe: FvIGS - ATAGGGTAGGCGGATCTGACTTGGCG with FAM+TAMRA, Qty: 1; - qPCR Probe: FvPrb3 - TTTGGTCTAGGGTAGGCCG with FAM+MGBNFQ, Qty: 1; - Probe: FbPrb1 - TGGGATGCCCT+AATTTTT+ACGG with HEX + 3IABkFQ, Qty: 1; - Primer: Fsgq1F - GATACCCAAGTAGTCTTTGCAGTAAATG, Qty: 1; - Primer: FSGq1 - GGCTGAACTGGCAACTTGGA, Qty: 1; - Primer: FVF - GCAGGCCATGTTGGTTCTGTA, Qty: 1; - Primer: FvIGSF1 - GGTGGTGCGGAAGGTCT, Qty: 1; -Primer: F63 - GTAAGTGAGATTTAGTCTAGGGTAGGTGAC, Qty: 1; - Primer: FbF2 - AGGTCAGATTTGGTATAGGGTAGGTGAGA, Qty: 1; - Primer: Fsgq1R - TTAATGCCTAGTCCCCTATCAACAT, Qty: 1; - Primer: FSGq2 - CAAAGCTTCATTCAATCCTAATACAATC, Qty: 1; - Primer: FVR: GCACGTAAAGTGAGTCGTCTCATC, Qty: 1; - Primer: FvIGSR3 - GTGAGTCGTCTCATC, Qty: 1; - Primer: R6 - GGGACCACCTACCCTACACCTACT, Qty: 1; - Primer: FbR2 - CGGACCATCCGTCTGGGAATTT, Qty: 1. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Quelle: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probe and Primers. Scope: - DNA Probe: 33P-GGATGGCAACGTACGTGACCCT with 6FAM + IBFQ, Qty: 01; - DNA Primer: 382F-ACCCAACAGACACTGTGCTC, Qty: 02; - DNA Primer: 49R-CAGTTTGTCAGTAATCGGTATTCG, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Quelle: ONLINE TENDERS

Extension of Closing Date: Bids are hereby invited for the following: Establishment of a panel of legal practitioners (attorneys and advocates) to the state for a period of thirty-six (36) months. Province: National. Quelle: ONLINE TENDERS

Addendum: Extension of Closing Date and Amendment to Document: Quotations are hereby invited for the appointment of a service provider to assist the DFFE/MLRF to conduct socio-economic study on hake handline, oysters, and white mussels for a period of 12 months. Scope: The study shall include but not limited to: - Evaluate the economic performance of the hake handline, oysters, and white mussel commercial fishing sectors, including revenue, profitability, and contribution to the local and national economy; - Examine the social implications of the hake handline, oysters, and white mussel commercial fishing sectors, including their role in providing employment, income distribution, and community well-being, particularly among small scale fishers; - Map out the entire value chains for the hake handline, oysters, and white mussel commercial fishing sectors, from harvesting and processing to distribution and consumption, highlighting key stakeholders and interactions. Delivery Address: Foretrust building, Cape Town, 8001. Please confirm the contract number as two were published. Quelle: ONLINE TENDERS

Tender Notic Quelle: PPRA SERVICES PORTAL

Tender Notice for the Executive Engineer, Highway Division, Hafizabad. Quelle: PPRA SERVICES PORTAL